Vector systems mobitec molecular biotechnology mobitec gmbh. Fiveminute cloning of taq polymeraseamplified pcr products. Swisspdbviewer aka deepview is an application that provides a user friendly interface allowing to analyze several proteins at the same time. Bacillus megaterium classic expression vectors pdf. Naturallyoccurring plasmids are viruses of bacteria. The bayou biolabs mmp18 sequence has a few differences from the mmp18 sequence reported in genbank, accession number x025. Bacillus megaterium high performance expression vectors pdf. It contains the pmb1 origin of replication from pbr322, but it lacks the rop gene and carries a point mutation in the rnaii transcript g 2975 in pbr322 to a 8 in puc19. The effect of increasing plasmid size on transformation efficiency in escherichia coli vicky chan, lisa f. The cut sites for some restriction enzyme are indicated on the plasmid.
Unique restriction sites, so that the restriction enzymes can be used to cut the plasmid and dna of interest can be inserted into the plasmid. The designation puc is derived from the classical p prefix denoting plasmid and the abbreviation for the university of california, where early work on the plasmid series had been conducted. The effect of increasing plasmid size on transformation. Created in 1977 in the laboratory of herbert boyer at the university of california, san francisco, it was named after francisco bolivar zapata, the postdoctoral researcher who constructed it. In the first article in this series, we talked about how origins of replication ori control plasmid replication and copy number. Since plasmid replicon type determines inc group, the terms inc and rep type were interchangeably used to describe plasmid types. What would have happened if only the hind iii enzyme was 2850178. A repository of over 200,000 plasmids including protein structure initiative protein expression plasmids and vectors, over 75,000 human plasmids, and whole genome collections from many organisms. The dna sequence of our mmp18 is 100% identical to the sequence of mmp18 from new england biolabs. Discrepancies between sequencing results obtained by addgene and the original sequence provided by the depositor may be present. Thermo scientific puc19 vector is a small, high copy number, e. This vector is not available from the plasmid repository and is provided here only as a reference.
Plasmid dna from escherichia coli rri has been used for imaging of dna nanostructure via atomic. Plasmid selection in escherichia coli using an endogenous. Replication origins of singlestrandeddna plasmid pub110. For the bayou biolabs mmp18 sequence, please click here. If you are having trouble with crashing in mojave or catalina, redownload to get the latest update. Marker genes there are a number of plasmids available as commercial vectors that can be purchased. Please acknowledge the principal investigator, cite the article. High copy number of the puc plasmid results from a romropsuppressible point mutation in rna ii. The plasmids designated puc18 or puc19 have been used extensively. Methods in molecular biologymethods in molecular biology tm volume 235 edited by nicola casali andrew preston e.
The molecule is a small doublestranded circle, 2686 base pairs in length, and has a high copy number. It contains identical multiple cloning site mcs as puc18 vector except that it is arranged in opposite orientation. The two replication origins of plasmid pub110 have been characterized. Plasmids pbr322 and puc8 pbr322 plasmid one of the first plasmids to be used in recombinant genetics was called pbr322. Xx rn 1 rp 12686 rc mmp18 from mmp8 rc mmp19 from mmp9 rc puc18 from puc8 rc puc19 from puc9 ra yanischperron c. This material is available to academics and nonprofits only. Initially, inc typing relied on introduction of a plasmid into a strain carrying another plasmid and determining whether both plasmids were stably maintained in the progeny. The features of this puc19 plasmids are as follows. Why are two different restriction enzymes used to cut the puc19 plasmid and the lux gene dna. Addgene ngs result gagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccg. Sequence provided by depositing laboratory may be theoreticalpredicted or based on sangerngs sequencing results. It contains identical multiple cloning site mcs as puc18 vector except that. The puc18puc19 sequence is stored as a pdffile on the genaxxon webpage it can be downloaded from the.
Mattenley department of microbiology and immunology, ubc based on the observation that the transformation of escherchia coli was more efficient with puc19 than with the larger. Why are two different restriction enzymes used to cut the. This plasmid has been modified to carry a gene for resistance to ampicillin the socalled ampr gene, which. Snapgene viewer is revolutionary software that allows molecular biologists to create, browse, and share richly annotated dna sequence files up to 1 gbp in length. Would you like to move beyond handdrawn plasmid maps. The puc18 puc19 sequence is stored as a pdf file on the genaxxon webpage. The artificial plasmid puc18 has been genetically engineered to include 1 a gene for antibiotic resistance to ampicillin amp r, and 2 a gene and its promoter for the enzyme betagalactosidase lacz. After amplifying a promoter sequence, transgene and activation domain and polya signal.
The site of initiation of dna replication at the plus origin was mapped to within an 8basepair sequence. This vector is designed for cloning and generation of exoiii deletions. Order by catalog number create your profile register for business account. The map, notes, and annotations on this page and in the sequencemap file are ed material. Highlights purified by chromatography using proprietary patented technology more than. Thermo scientific plasmid puc57, 2710 bp in length, is a derivative of puc19. The proteins can be superimposed in order to deduce structural alignments and compare their active sites or any other relevant parts. Nov 26, 2014 today i would like to introduce you to puc18, a plasmid most noted for its high copy number. Please sign in to view account pricing and product availability. Plasmid dna from escherichia coli rri has been used in polymerase chain reaction pcr. Principle foreign dna inserted at the mcs interrupts the. Aug 11, 2008 the puc19 multiple cloning site mcs is retained, however hincii, hindiii and psti are not unique in pfab. The fabi cassette was also inserted into the mcs of puc19 to obtain pucfa. Standard cloning vector phagemid excised from lambda zapii.
The focus of this study was the construction of a novel enlarged puc19 vector, pbart, which carries the rop and tetracycline resistance genes derived from pbr322. Use experimental dna that is free of phenol, ethanol, salts, protein, and detergents to obtain maximum transformation efficiency. The molecule is doublestranded circle, 2686 base pairs in length, and has a high copy number. The fabi cassette in pfab can be transferred to other pucderived plasmids using the aatii and alwni restriction sites. Snapgene viewer free software for plasmid mapping, primer.
1357 271 1120 859 1535 1083 1474 708 1051 1383 27 71 483 254 19 1514 474 1330 814 255 1003 748 1298 356 1018 985 171 1262 1412 826 985 1453 330 591 627